Two different ways to translate mRNA to Protein

from Bio.Seq import Seq
from Bio.Alphabet import IUPAC


def translate(mRNA):
    '''(str) -> str

    input is mRNA string and it returns a the corresponding protein string.

    >>>translate('AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA')
    MAMPRTEINSTRING

    Precondition: mRNA has to be Uppercase and include only GAUC
   
    '''
    #IUPAC.unambiguous_rna includes only Uppercase and GAUC
    messenger_rna = Seq(mRNA, IUPAC.unambiguous_rna)
    #translate using a dict already stored in the method
    protein = messenger_rna.translate()

    print protein

--------------------------------------------

def translate_2(mRNA):
    '''(str) -> str

    input is mRNA string and it returns a the corresponding protein string.

    >>>translate('AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA')
    MAMPRTEINSTRING
   
    '''
    #this string will be used to make a dict
    translation_table = '''UUU F      CUU L      AUU I      GUU V
    UUC F      CUC L      AUC I      GUC V
    UUA L      CUA L      AUA I      GUA V
    UUG L      CUG L      AUG M      GUG V
    UCU S      CCU P      ACU T      GCU A
    UCC S      CCC P      ACC T      GCC A
    UCA S      CCA P      ACA T      GCA A
    UCG S      CCG P      ACG T      GCG A
    UAU Y      CAU H      AAU N      GAU D
    UAC Y      CAC H      AAC N      GAC D
    UAA Stop   CAA Q      AAA K      GAA E
    UAG Stop   CAG Q      AAG K      GAG E
    UGU C      CGU R      AGU S      GGU G
    UGC C      CGC R      AGC S      GGC G
    UGA Stop   CGA R      AGA R      GGA G
    UGG W      CGG R      AGG R      GGG G'''

    #Make a list of the above string and remove all spaces or '/n
    translation_list =  translation_table.split()
    #Make dictionary from list
    translation_dict = dict(zip(translation_list[0::2], translation_list[1::2]))

    #Accumulator variable
    protein = ''
    for aa in range(0, len(mRNA)-3, 3):
        protein += translation_dict[mRNA[aa:aa+3]]

    print protein

Installing biopython on Mac OS X 10.5 and Mac OS X 10.8

Installing on Mac OS X 10.5

1. Install XCode
 - https://connect.apple.com/cgi-bin/WebObjects/MemberSite.woa/wa/getSoftware?bundleID=20414 from apple
 - Just use default install 

2.  Install NumPy
 - download http://sourceforge.net/projects/numpy/files/
 - double click on the file and it will unzip
 - I then placed the unzipped file on the desktop(shorter directory address)
 - then open terminal
 - navigate to the file
  - example
   cd /Users/computername/Desktop/numpy-1.7.0
 - then type in terminal python setup.py build (note this takes a little while to complete and as some  points it looks like to stalled.  Just wait.)
 - then type into terminal sudo python setup.py install

3. Install biopython
 - download source zip file from http://biopython.org/wiki/Download
 - double click on it and it will unzip
 - I then placed the unzipped file on the desktop(shorter directory address)
 - then open terminal
 - navigate to the file
 - type python setup.py build
 - python setup.py test
 - sudo python setup.py install

4. go to idle and test if you installed everything

>>> import numpy
>>> print numpy.__version__
1.7.0

>>> import Bio

>>> print Bio.__version__
1.61 

Installing on Mac OS X 10.8

1. Install XCode.
  - Download XCode from the Mac App Store and install

2. Install XCode the command line tools
  - Open XCode
  - Go to XCode on toolbar -> preferences -> Downloads -> click on install Command Line Tools
   - Command Line Tools are already installed on my computer therefore it says update

3. Install MacPorts
  - Download Mountain Lion MacPorts "pkg" installer

4.  Install NumPy
 - download http://sourceforge.net/projects/numpy/files/
 - double click on the file and it will unzip

 - I then placed the unzipped file on the desktop(shorter directory address)
 - then open terminal
 - navigate to the file
  - example
   cd /Users/computername/Desktop/numpy-1.7.0
 - then type in terminal python setup.py build (note this takes a little while to complete and as some  points it looks like to stalled.  Just wait.)
 - then type into terminal sudo python setup.py install

5. Install biopython
 - download source zip file from http://biopython.org/wiki/Download
 - double click on it and it will unzip
 - I then placed the unzipped file on the desktop(shorter directory address)
 - then open terminal
 - navigate to the file
 - type python setup.py build
 - python setup.py test
 - sudo python setup.py install

6. go to idle and test if you installed everything

>>> import numpy
>>> print numpy.__version__
1.7.0

>>> import Bio

>>> print Bio.__version__
1.61